Transcript: Mouse NM_029271.2

Mus musculus mitochondrial ribosomal protein L32 (Mrpl32), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Mrpl32 (75398)
Length:
768
CDS:
20..583

Additional Resources:

NCBI RefSeq record:
NM_029271.2
NBCI Gene record:
Mrpl32 (75398)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029271.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000328092 ACATGTCCTTTGTGGATATTG pLKO_005 373 CDS 100% 13.200 9.240 N Mrpl32 n/a
2 TRCN0000328159 GCTCCTTCCGTTGAGACTATG pLKO_005 467 CDS 100% 10.800 7.560 N Mrpl32 n/a
3 TRCN0000215491 GTGGATATTGCTATGAGAAAG pLKO.1 384 CDS 100% 10.800 7.560 N Mrpl32 n/a
4 TRCN0000189652 CAGACGCACCATCGAAGTTAA pLKO.1 265 CDS 100% 13.200 7.920 N Mrpl32 n/a
5 TRCN0000328155 CAGACGCACCATCGAAGTTAA pLKO_005 265 CDS 100% 13.200 7.920 N Mrpl32 n/a
6 TRCN0000216668 CTTGGTTCACCCAGAATTGAA pLKO.1 564 CDS 100% 5.625 3.375 N Mrpl32 n/a
7 TRCN0000191608 GCAAGAGGATTGTTGAAAGAA pLKO.1 528 CDS 100% 5.625 3.375 N Mrpl32 n/a
8 TRCN0000328156 GCAAGAGGATTGTTGAAAGAA pLKO_005 528 CDS 100% 5.625 3.375 N Mrpl32 n/a
9 TRCN0000192227 CAGGAGAGAAACCATCAGAAA pLKO.1 498 CDS 100% 4.950 2.970 N Mrpl32 n/a
10 TRCN0000202041 CGTTGAGACTATGGTGCTGTA pLKO.1 475 CDS 100% 4.050 2.430 N Mrpl32 n/a
11 TRCN0000191547 GATAATTTCATAGTTAGGCAC pLKO.1 602 3UTR 100% 2.160 1.296 N Mrpl32 n/a
12 TRCN0000328157 GATAATTTCATAGTTAGGCAC pLKO_005 602 3UTR 100% 2.160 1.296 N Mrpl32 n/a
13 TRCN0000201146 CCATCGAAGTTAACCGATGTA pLKO.1 273 CDS 100% 0.495 0.248 Y Mrpl32 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029271.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.