Transcript: Mouse NM_029332.1

Mus musculus A kinase (PRKA) anchor protein 13 (Akap13), mRNA.

Source:
NCBI, updated 2017-04-22
Taxon:
Mus musculus (mouse)
Gene:
Akap13 (75547)
Length:
12543
CDS:
227..8557

Additional Resources:

NCBI RefSeq record:
NM_029332.1
NBCI Gene record:
Akap13 (75547)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029332.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000265561 GCCAACCTGACCGAGAGTATA pLKO_005 5255 CDS 100% 13.200 18.480 N Akap13 n/a
2 TRCN0000254530 ACGTATTCCTCATTTCGTTTA pLKO_005 9145 3UTR 100% 10.800 15.120 N Akap13 n/a
3 TRCN0000254529 GTCTAAACAACAGGGATTTAA pLKO_005 5131 CDS 100% 15.000 12.000 N Akap13 n/a
4 TRCN0000254531 CCATGGAGAAAGCCGATATTA pLKO_005 1803 CDS 100% 15.000 10.500 N Akap13 n/a
5 TRCN0000265562 TGAGAGTGCAGAGCGCTTAAA pLKO_005 6376 CDS 100% 13.200 7.920 N Akap13 n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 11800 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029332.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.