Transcript: Mouse NM_029606.3

Mus musculus centrosomal protein 112 (Cep112), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Cep112 (76380)
Length:
3516
CDS:
202..3066

Additional Resources:

NCBI RefSeq record:
NM_029606.3
NBCI Gene record:
Cep112 (76380)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029606.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000184619 GAACTAGAAACCCGCTCTCAT pLKO.1 2818 CDS 100% 4.950 6.930 N Cep112 n/a
2 TRCN0000292778 GAACTAGAAACCCGCTCTCAT pLKO_005 2818 CDS 100% 4.950 6.930 N Cep112 n/a
3 TRCN0000180757 GCGTCTCTAAGACAAGAACTT pLKO.1 2947 CDS 100% 4.950 3.960 N Cep112 n/a
4 TRCN0000292704 GCGTCTCTAAGACAAGAACTT pLKO_005 2947 CDS 100% 4.950 3.960 N Cep112 n/a
5 TRCN0000179475 GCAGAACTTCAGACAACCATT pLKO.1 2662 CDS 100% 4.950 3.465 N CEP112 n/a
6 TRCN0000180489 GCAGGAGCAGATAATGTACAT pLKO.1 2886 CDS 100% 4.950 3.465 N Cep112 n/a
7 TRCN0000292713 GCAGGAGCAGATAATGTACAT pLKO_005 2886 CDS 100% 4.950 3.465 N Cep112 n/a
8 TRCN0000184426 GAAGAACTGACCACCTACCAA pLKO.1 3034 CDS 100% 3.000 2.100 N Cep112 n/a
9 TRCN0000292779 GAAGAACTGACCACCTACCAA pLKO_005 3034 CDS 100% 3.000 2.100 N Cep112 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029606.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13386 pDONR223 100% 82.1% 82.8% None (many diffs) n/a
2 ccsbBroad304_13386 pLX_304 0% 82.1% 82.8% V5 (many diffs) n/a
Download CSV