Transcript: Mouse NM_029624.4

Mus musculus lipase maturation factor 1 (Lmf1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Lmf1 (76483)
Length:
1861
CDS:
14..1738

Additional Resources:

NCBI RefSeq record:
NM_029624.4
NBCI Gene record:
Lmf1 (76483)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029624.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000428566 ACCTATGCACCAACCATTATG pLKO_005 335 CDS 100% 13.200 18.480 N Lmf1 n/a
2 TRCN0000438108 ACGTAGGGCAGATCTGGTATT pLKO_005 501 CDS 100% 10.800 15.120 N Lmf1 n/a
3 TRCN0000173731 CTCAGGATCGTCAACACCTAT pLKO.1 1217 CDS 100% 4.950 6.930 N Lmf1 n/a
4 TRCN0000437471 ACCTTCTGGCTGACTAGAATC pLKO_005 155 CDS 100% 10.800 7.560 N Lmf1 n/a
5 TRCN0000427363 TCAGAGGGAAGATACACAAAG pLKO_005 1051 CDS 100% 10.800 7.560 N Lmf1 n/a
6 TRCN0000436317 CGCAAGCGAATTGGTCCTTAC pLKO_005 1628 CDS 100% 6.000 4.200 N Lmf1 n/a
7 TRCN0000193658 CCGTGGTTATCAATCTGCTAA pLKO.1 1161 CDS 100% 4.950 3.465 N Lmf1 n/a
8 TRCN0000193755 CTGGTCAGACATGAACTTCAA pLKO.1 367 CDS 100% 4.950 3.465 N Lmf1 n/a
9 TRCN0000172638 GCATGGACTTCCACTATGAGA pLKO.1 723 CDS 100% 3.000 2.100 N LMF1 n/a
10 TRCN0000173511 GCAGATCATGAACACCTCCTT pLKO.1 1189 CDS 100% 2.640 1.848 N Lmf1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029624.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.