Transcript: Mouse NM_029733.3

Mus musculus RIKEN cDNA 2010005H15 gene (2010005H15Rik), mRNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
2010005H15Rik (76770)
Length:
528
CDS:
180..473

Additional Resources:

NCBI RefSeq record:
NM_029733.3
NBCI Gene record:
2010005H15Rik (76770)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029733.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000080312 TCACAGGGATTTCTGGAGAAA pLKO.1 388 CDS 100% 4.950 2.970 N 2010005H15Rik n/a
2 TRCN0000080311 AGTGTTCAAAGCTGTTGAGTA pLKO.1 287 CDS 100% 4.950 2.475 Y 2010005H15Rik n/a
3 TRCN0000080309 CACACCAGAAATCCAGGAGAT pLKO.1 215 CDS 100% 4.050 2.025 Y 2010005H15Rik n/a
4 TRCN0000080310 TGGTGGTTGTTTCCTCCACAT pLKO.1 359 CDS 100% 4.050 2.025 Y 2010005H15Rik n/a
5 TRCN0000092416 CCAATGAGAAATATGAAGTGT pLKO.1 271 CDS 100% 3.000 1.500 Y Cstdc4 n/a
6 TRCN0000092417 AGATGGATGTTGGTGGTGGTT pLKO.1 346 CDS 100% 2.640 1.320 Y Cstdc4 n/a
7 TRCN0000080308 GCTGTTGAGTATAAATCTCAA pLKO.1 297 CDS 100% 0.495 0.248 Y 2010005H15Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029733.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.