Transcript: Mouse NM_029760.2

Mus musculus nucleotide binding protein-like (Nubpl), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Nubpl (76826)
Length:
1230
CDS:
39..998

Additional Resources:

NCBI RefSeq record:
NM_029760.2
NBCI Gene record:
Nubpl (76826)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029760.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000253199 GCCAAAGCTTACCTGCATATT pLKO_005 936 CDS 100% 13.200 18.480 N Nubpl n/a
2 TRCN0000253197 TATAAGGGAAGCTTCGGATAT pLKO_005 875 CDS 100% 10.800 15.120 N Nubpl n/a
3 TRCN0000253196 TTGGAGAGGCCTTATGGTAAT pLKO_005 503 CDS 100% 10.800 15.120 N Nubpl n/a
4 TRCN0000253195 TGGAAATTGTCCTGGTATTTG pLKO_005 1012 3UTR 100% 13.200 9.240 N Nubpl n/a
5 TRCN0000253198 GGTATTGCTTGTATGTCAATG pLKO_005 450 CDS 100% 10.800 7.560 N Nubpl n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029760.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12686 pDONR223 100% 78.8% 80.8% None (many diffs) n/a
2 ccsbBroad304_12686 pLX_304 0% 78.8% 80.8% V5 (many diffs) n/a
3 TRCN0000492280 AAAACTATACCCAGTACGAGCCAT pLX_317 50.2% 78.8% 80.8% V5 (many diffs) n/a
Download CSV