Construct: ORF TRCN0000492280
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF010781.1_s317c1
- Derived from:
- ccsbBroadEn_12686
- DNA Barcode:
- AAAACTATACCCAGTACGAGCCAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- NUBPL (80224)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000492280
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 80224 | NUBPL | nucleotide binding protein ... | NM_025152.3 | 90.4% | 90.2% | 1_90del;593A>C |
| 2 | human | 80224 | NUBPL | nucleotide binding protein ... | NM_001201573.1 | 77% | 76.4% | 0_1ins196;2_3insTC;305A>C |
| 3 | human | 80224 | NUBPL | nucleotide binding protein ... | XM_011537181.2 | 73.5% | 62.2% | (many diffs) |
| 4 | human | 80224 | NUBPL | nucleotide binding protein ... | XM_011537182.2 | 65.2% | 65% | 0_1ins300;203A>C |
| 5 | human | 80224 | NUBPL | nucleotide binding protein ... | XM_017021667.1 | 61.4% | 61.2% | 0_1ins333;170A>C |
| 6 | human | 80224 | NUBPL | nucleotide binding protein ... | XM_017021664.1 | 49.4% | 43.2% | (many diffs) |
| 7 | human | 80224 | NUBPL | nucleotide binding protein ... | XM_017021665.2 | 47.1% | 45.3% | (many diffs) |
| 8 | human | 80224 | NUBPL | nucleotide binding protein ... | NM_001201574.1 | 46.9% | 46.7% | 0_1ins459;44A>C |
| 9 | human | 80224 | NUBPL | nucleotide binding protein ... | XM_011537184.3 | 46.9% | 46.7% | 0_1ins459;44A>C |
| 10 | human | 80224 | NUBPL | nucleotide binding protein ... | XM_011537183.2 | 46.6% | 45.1% | (many diffs) |
| 11 | human | 80224 | NUBPL | nucleotide binding protein ... | XM_017021666.1 | 45.8% | 44.5% | (many diffs) |
| 12 | human | 80224 | NUBPL | nucleotide binding protein ... | NR_120408.2 | 25.4% | 1_126del;546_547ins94;900_2946del | |
| 13 | mouse | 76826 | Nubpl | nucleotide binding protein-... | NM_029760.2 | 78.8% | 80.8% | (many diffs) |
| 14 | mouse | 76826 | Nubpl | nucleotide binding protein-... | XM_006516363.1 | 71.4% | 67.2% | (many diffs) |
| 15 | mouse | 76826 | Nubpl | nucleotide binding protein-... | XM_006516362.2 | 40.9% | 41.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 933
- ORF length:
- 867
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggt ttgtgggcgc cagttgtctg gcgccgggag tgagacccta aaacaaagaa 121 gaacacaaat catgtcccga ggacttccaa agcagaaacc gatagaaggt gttaaacaag 181 ttatagttgt ggcttctgga aagggtggag tcggaaaatc tactacagca gtgaatcttg 241 cacttgcact agcagcgaac gattcgtcca aggccattgg tttgctagat gtggatgtgt 301 atggaccttc agttccaaag atgatgaatc tgaaaggaaa tccggaatta tcacagagca 361 acctaatgag gcctctcttg aattatggta ttgcttgtat gtctatgggc tttctggttg 421 aagaaagtga accagtagtt tggagaggcc ttatggtaat gtcggccatt gagaaattgt 481 tgaggcaggt agattggGGT CAACTGGACT ACTTAGTTGT AGACATGCCA CCAGGAACTG 541 GAGATGTGCA GTTATCAGTC TCACAGACTA TTCCTATAAC AGGTGCTGTG ATTGTCTCCA 601 CGCCCCAGGA CATCGCATTG ATGGATGCAC ACAAGGGTGC TGAGATGTTT CGCAGAGTCC 661 ACGTGCCCGT CCTTGGCCTT GTCCAAAACA TGAGTGTTTT CCAGTGTCCA AAATGTAAAC 721 ACAAAACTCA TATTTTTGGT GCTGATGGTG CAAGGAAACT AGCACAGACC CTTGGTCTTG 781 AAGTTCTAGG AGACATTCCC TTACACCTTA ATATAAGGGA AGCTTCAGAT ACAGGCCAGC 841 CAATTGTGTT TTCACAGCCT GAAAGTGATG AGGCCAAAGC TTACTTGAGG ATTGCTGTGG 901 AAGTGGTAAG AAGATTGCCA TCACCTTCAG AATGCCCAAC TTTCTTGTAC AAAGTGGTTG 961 ATATCGGTAA GCCTATCCCT AACCCTCTCC TCGGTCTCGA TTCTACGTAG TAATGAACTA 1021 GTCCGTAACT TGAAAGTATT TCGATTTCTT GGCTTTATAT ATCTTGTGGA AAGGACGAAA 1081 AACTATACCC AGTACGAGCC ATACGCGTTA AGTCgacaat caacctctgg attacaaaat 1141 ttgtgaaaga tt