Transcript: Mouse NM_029810.4

Mus musculus 5'-nucleotidase, cytosolic II (Nt5c2), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Nt5c2 (76952)
Length:
3769
CDS:
100..1782

Additional Resources:

NCBI RefSeq record:
NM_029810.4
NBCI Gene record:
Nt5c2 (76952)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029810.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000081444 CGGATTAAGAAAGTAACTCAT pLKO.1 1363 CDS 100% 4.950 6.930 N Nt5c2 n/a
2 TRCN0000327330 CGGATTAAGAAAGTAACTCAT pLKO_005 1363 CDS 100% 4.950 6.930 N Nt5c2 n/a
3 TRCN0000081445 CGCACGTCAGTGGATTTCAAA pLKO.1 1624 CDS 100% 5.625 4.500 N Nt5c2 n/a
4 TRCN0000327333 CGCACGTCAGTGGATTTCAAA pLKO_005 1624 CDS 100% 5.625 4.500 N Nt5c2 n/a
5 TRCN0000081447 GCAGTCCTACTTTGACCTGAT pLKO.1 936 CDS 100% 4.050 3.240 N Nt5c2 n/a
6 TRCN0000081446 CAGTCCTACTTTGACCTGATT pLKO.1 937 CDS 100% 4.950 3.465 N Nt5c2 n/a
7 TRCN0000327331 CAGTCCTACTTTGACCTGATT pLKO_005 937 CDS 100% 4.950 3.465 N Nt5c2 n/a
8 TRCN0000306659 GCTACTAACAGTGACTATAAG pLKO_005 841 CDS 100% 13.200 7.920 N Nt5c2 n/a
9 TRCN0000081443 CCTGGAAAGTTTGGAAAGTTT pLKO.1 1890 3UTR 100% 5.625 3.375 N Nt5c2 n/a
10 TRCN0000327332 CCTGGAAAGTTTGGAAAGTTT pLKO_005 1890 3UTR 100% 5.625 3.375 N Nt5c2 n/a
11 TRCN0000050949 CCTGCTAACATGGATAAGCAT pLKO.1 145 CDS 100% 3.000 1.800 N NT5C2 n/a
12 TRCN0000179671 GATGATGATGAAGAGGAAGAA pLKO.1 1750 CDS 100% 4.950 2.475 Y Ldoc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029810.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.