Transcript: Mouse NM_029832.2

Mus musculus DDRGK domain containing 1 (Ddrgk1), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Ddrgk1 (77006)
Length:
1101
CDS:
81..1028

Additional Resources:

NCBI RefSeq record:
NM_029832.2
NBCI Gene record:
Ddrgk1 (77006)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029832.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000265501 ACGGAGAACCACTGCACAATG pLKO_005 175 CDS 100% 10.800 15.120 N Ddrgk1 n/a
2 TRCN0000254221 AGGACTCAGGACGCCATAAAC pLKO_005 804 CDS 100% 13.200 9.240 N Ddrgk1 n/a
3 TRCN0000254223 AGCACGAGGAGTACCTGAAAC pLKO_005 637 CDS 100% 10.800 7.560 N Ddrgk1 n/a
4 TRCN0000254222 GGATGAGAATGTGGGTCAAAC pLKO_005 347 CDS 100% 10.800 7.560 N Ddrgk1 n/a
5 TRCN0000265479 GGTAGAAGAAGAAGGTGTTAG pLKO_005 674 CDS 100% 10.800 7.560 N Ddrgk1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029832.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04004 pDONR223 100% 85.4% 84.1% None (many diffs) n/a
2 ccsbBroad304_04004 pLX_304 0% 85.4% 84.1% V5 (many diffs) n/a
3 TRCN0000471960 CTCACAGCATTGCCAAGGGCTGCA pLX_317 47.8% 85.4% 84.1% V5 (many diffs) n/a
4 ccsbBroadEn_08895 pDONR223 100% 85.3% 83.8% None (many diffs) n/a
5 ccsbBroad304_08895 pLX_304 0% 85.3% 83.8% V5 (many diffs) n/a
6 TRCN0000471509 CTTCCTGTTTCTGCGATAGTGATT pLX_317 52.1% 85.3% 83.8% V5 (many diffs) n/a
Download CSV