Construct: ORF TRCN0000471509
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF013856.1_s317c1
- Derived from:
- ccsbBroadEn_08895
- DNA Barcode:
- CTTCCTGTTTCTGCGATAGTGATT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- DDRGK1 (65992)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000471509
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 65992 | DDRGK1 | DDRGK domain containing 1 | NM_023935.3 | 99.7% | 99.3% | 290T>C;907G>A |
| 2 | mouse | 77006 | Ddrgk1 | DDRGK domain containing 1 | NM_029832.2 | 85.3% | 83.8% | (many diffs) |
| 3 | mouse | 77006 | Ddrgk1 | DDRGK domain containing 1 | XR_001783204.1 | 60.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1008
- ORF length:
- 942
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggt ggcgcctgtg tggtacttgg tagcggcggc tctgctagtc ggctttatcc 121 tcttcctgac tcgcagccgg ggccgggcgg catcagccgg ccaagagcca ctgcacaatg 181 aggagctggc aggagcaggc cgggtggccc agcctgggcc cctggagcct gaggagccga 241 gagctggagg caggcctcgg cgccggaggg acctgggcag ccgcctacag gcccagcgtc 301 gagcccagcg ggtggcctgg gcagaagcag atgagaacga ggaggaagct gtcaccctag 361 cccaggagga ggaaggtgtc gagaagccag cggaaactca cctgtcgggg aaaattggag 421 ctaagaaact gcggaagctg gaggagaaac aagcgcgaaa ggcccagcgt gaggcagagg 481 aggctgaacg tgaggagcgg aaacgactcg agtcccAGCG CGAAGCTGAG TGGAAGAAGG 541 AGGAGGAGCG GCTTCGCCTG GAGGAGGAGC AGAAGGAGGA GGAGGAGAGG AAGGCCCGCG 601 AGGAGCAGGC CCAGCGGGAG CATGAGGAGT ACCTGAAACT GAAGGAGGCC TTTGTGGTGG 661 AGGAGGAAGG CGTAGGAGAG ACCATGACTG AGGAACAGTC CCAGAGCTTC CTGACAGAGT 721 TCATCAACTA CATCAAGCAG TCCAAGGTTG TGCTCTTGGA AGACCTGGCT TCCCAGGTGG 781 GCCTACGCAC TCAGGACACC ATAAATCGCA TCCAGGACCT GCTGGCTGAG GGGACTATAA 841 CAGGTGTGAT TGACGACCGG GGCAAGTTCA TCTACATAAC CCCAGAGGAA CTGGCCGCCG 901 TGGCCAACTT CATCCGACAG CGGGGCCGGG TGTCCATCGC CGAGCTTGCC CAAGCCAGCA 961 ACTCCCTCAT CACCTGGGGC CGGGAGTCCC CTGCCCAAGC CCCAGCCTGC CCAACTTTCT 1021 TGTACAAAGT GGTTGATATC GGTAAGCCTA TCCCTAACCC TCTCCTCGGT CTCGATTCTA 1081 CGTAGTAATG AACTAGTCCG TAACTTGAAA GTATTTCGAT TTCTTGGCTT TATATATCTT 1141 GTGGAAAGGA CGACTTCCTG TTTCTGCGAT AGTGATTACG CGTTAAGTCg acaatcaacc 1201 tctggattac aaaatttgtg aaagatt