Transcript: Mouse NM_029872.1

Mus musculus heterogeneous nuclear ribonucleoprotein A0 (Hnrnpa0), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Hnrnpa0 (77134)
Length:
2678
CDS:
244..1161

Additional Resources:

NCBI RefSeq record:
NM_029872.1
NBCI Gene record:
Hnrnpa0 (77134)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029872.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

No results found.

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029872.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14980 pDONR223 65.4% 82% 90% None (many diffs) n/a
2 ccsbBroad304_14980 pLX_304 0% 82% 90% V5 (many diffs) n/a
3 TRCN0000468258 GCTAACATTCCGTACCTTGTTAGC pLX_317 70.8% 54.6% 59.3% V5 (many diffs) n/a
Download CSV