Transcript: Mouse NM_029933.4

Mus musculus B cell CLL/lymphoma 9 (Bcl9), mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Bcl9 (77578)
Length:
6102
CDS:
627..4904

Additional Resources:

NCBI RefSeq record:
NM_029933.4
NBCI Gene record:
Bcl9 (77578)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029933.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000314152 GCGGAAGCCTTTGGATATATC pLKO_005 3149 CDS 100% 13.200 18.480 N Bcl9 n/a
2 TRCN0000314207 TTTGATCTCTCCCGCATTATC pLKO_005 4323 CDS 100% 13.200 18.480 N Bcl9 n/a
3 TRCN0000109299 CTCCATTATGATGTCTCGAAT pLKO.1 3641 CDS 100% 4.950 6.930 N Bcl9 n/a
4 TRCN0000109296 GCGCAATCTCAGAGAACCAAT pLKO.1 3014 CDS 100% 4.950 3.960 N Bcl9 n/a
5 TRCN0000317945 GCGCAATCTCAGAGAACCAAT pLKO_005 3014 CDS 100% 4.950 3.960 N Bcl9 n/a
6 TRCN0000314208 TTCTACGGAGATGGCAAATAA pLKO_005 1166 CDS 100% 15.000 10.500 N Bcl9 n/a
7 TRCN0000314150 ATCCTTGTCAAGATGAGATTC pLKO_005 4927 3UTR 100% 10.800 7.560 N Bcl9 n/a
8 TRCN0000109295 CCTTACTGTTGGTCATGCAAT pLKO.1 4985 3UTR 100% 4.950 3.465 N Bcl9 n/a
9 TRCN0000109297 CCATGATGTCTCAATCCCAAA pLKO.1 1849 CDS 100% 4.050 2.835 N Bcl9 n/a
10 TRCN0000109298 CCAGAACATCTCTAACAGCAA pLKO.1 1241 CDS 100% 2.640 1.848 N Bcl9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029933.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.