Transcript: Mouse NM_030087.2

Mus musculus NADH dehydrogenase (ubiquinone) flavoprotein 3 (Ndufv3), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Ndufv3 (78330)
Length:
1594
CDS:
100..1506

Additional Resources:

NCBI RefSeq record:
NM_030087.2
NBCI Gene record:
Ndufv3 (78330)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_030087.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000340351 CCAGTGCCCACAACGCAAATA pLKO_005 1012 CDS 100% 13.200 18.480 N Ndufv3 n/a
2 TRCN0000099271 CAAACGATTCATCTTCATCTT pLKO.1 545 CDS 100% 4.950 3.960 N Ndufv3 n/a
3 TRCN0000099274 CGTGCAGAAAGTGACAAACGA pLKO.1 531 CDS 100% 3.000 2.400 N Ndufv3 n/a
4 TRCN0000340431 CACGTGCAGAAAGTGACAAAC pLKO_005 529 CDS 100% 10.800 7.560 N Ndufv3 n/a
5 TRCN0000340429 GTGAAGCTGAAGGAATCTTAC pLKO_005 947 CDS 100% 10.800 7.560 N Ndufv3 n/a
6 TRCN0000340430 TCAGAAACCAGTGAGCTATTC pLKO_005 1206 CDS 100% 10.800 7.560 N Ndufv3 n/a
7 TRCN0000340428 TGAAGGGCTTCCGAAGCATTT pLKO_005 426 CDS 100% 10.800 7.560 N Ndufv3 n/a
8 TRCN0000099273 CAGGAGAAAGATACTGTTGAA pLKO.1 1243 CDS 100% 4.950 3.465 N Ndufv3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_030087.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.