Transcript: Mouse NM_030137.2

Mus musculus CSA-conditional, T cell activation-dependent protein (Cstad), mRNA.

Source:
NCBI, updated 2017-04-28
Taxon:
Mus musculus (mouse)
Gene:
Cstad (78617)
Length:
833
CDS:
27..341

Additional Resources:

NCBI RefSeq record:
NM_030137.2
NBCI Gene record:
Cstad (78617)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_030137.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000246781 AGCCATCATGAGTTGGTACAG pLKO_005 284 CDS 100% 4.050 5.670 N Cstad n/a
2 TRCN0000246778 TAACGGAGGCTCACAAGGAAG pLKO_005 89 CDS 100% 4.050 5.670 N Cstad n/a
3 TRCN0000246780 AGCACAGAGGATGTACGTTAA pLKO_005 121 CDS 100% 10.800 7.560 N Cstad n/a
4 TRCN0000246777 CCTGGCTCACCACATAGTTTC pLKO_005 257 CDS 100% 10.800 7.560 N Cstad n/a
5 TRCN0000195910 CGATGGAGAGAGAGAGTTCAA pLKO.1 342 CDS 100% 4.950 3.465 N Cstad n/a
6 TRCN0000183084 CAGAACGAACTTCAGAAAGTT pLKO.1 498 3UTR 100% 0.563 0.394 N Cstad n/a
7 TRCN0000246779 TCCATCCCAGGAACCTATGAA pLKO_005 465 3UTR 100% 5.625 3.375 N Cstad n/a
8 TRCN0000178741 CACACACATACACACACACAA pLKO.1 572 3UTR 100% 4.950 2.475 Y Cstad n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_030137.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.