Transcript: Mouse NM_030172.2

Mus musculus EF-hand calcium binding domain 11 (Efcab11), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Efcab11 (78767)
Length:
2069
CDS:
87..575

Additional Resources:

NCBI RefSeq record:
NM_030172.2
NBCI Gene record:
Efcab11 (78767)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_030172.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000346182 AGAAGGAAGCGCGACTCTATC pLKO_005 343 CDS 100% 10.800 8.640 N Efcab11 n/a
2 TRCN0000267783 GACGTGCACTATCGTGGATTT pLKO_005 396 CDS 100% 10.800 8.640 N Efcab11 n/a
3 TRCN0000283546 ACAAGCTTCATGCTCATATAA pLKO_005 1535 3UTR 100% 15.000 10.500 N Efcab11 n/a
4 TRCN0000267784 AGATTTCAAGAGGGCGTTTAG pLKO_005 428 CDS 100% 10.800 7.560 N Efcab11 n/a
5 TRCN0000190772 GAGGCAGATCAAGACTCAGAT pLKO.1 498 CDS 100% 4.950 3.465 N Efcab11 n/a
6 TRCN0000191853 GCAGAAATGAATTACTGGTAT pLKO.1 1913 3UTR 100% 4.950 3.465 N Efcab11 n/a
7 TRCN0000267782 CCTAAGCCGAGAGGACTTTAA pLKO_005 197 CDS 100% 13.200 7.920 N Efcab11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_030172.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.