Transcript: Mouse NM_030563.2

Mus musculus NEDD4 binding protein 1 (N4bp1), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
N4bp1 (80750)
Length:
6469
CDS:
240..2921

Additional Resources:

NCBI RefSeq record:
NM_030563.2
NBCI Gene record:
N4bp1 (80750)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_030563.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000339340 AGTTACTCTTGAGTGTATTTA pLKO_005 3167 3UTR 100% 15.000 21.000 N N4bp1 n/a
2 TRCN0000339409 GCACAGCGCCAAGGAGTATAT pLKO_005 425 CDS 100% 13.200 18.480 N N4bp1 n/a
3 TRCN0000351021 TCTCGCAGTTACCGTTCAAAG pLKO_005 1561 CDS 100% 10.800 15.120 N N4bp1 n/a
4 TRCN0000339338 AGCAATTGCAGTTGAGTATTT pLKO_005 2159 CDS 100% 13.200 9.240 N N4bp1 n/a
5 TRCN0000130119 CTGCCTGTTCAGAACTGTTTA pLKO.1 3141 3UTR 100% 13.200 9.240 N N4BP1 n/a
6 TRCN0000285994 CTGCCTGTTCAGAACTGTTTA pLKO_005 3141 3UTR 100% 13.200 9.240 N N4BP1 n/a
7 TRCN0000128563 GCAGTTACTCTTGAGTGTATT pLKO.1 3165 3UTR 100% 13.200 9.240 N N4BP1 n/a
8 TRCN0000277672 GCAGTTACTCTTGAGTGTATT pLKO_005 3165 3UTR 100% 13.200 9.240 N N4BP1 n/a
9 TRCN0000146676 CCCAAGCCAATAAATAGCATT pLKO.1 3750 3UTR 100% 4.950 3.465 N N4BP1 n/a
10 TRCN0000339407 GAGCAGATTTGAAGCATATTG pLKO_005 2074 CDS 100% 13.200 7.920 N N4bp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_030563.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.