Transcript: Mouse NM_030725.4

Mus musculus synaptotagmin XIII (Syt13), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Syt13 (80976)
Length:
3751
CDS:
87..1367

Additional Resources:

NCBI RefSeq record:
NM_030725.4
NBCI Gene record:
Syt13 (80976)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_030725.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000093425 CGGCCCAACAGTTCAACATTA pLKO.1 259 CDS 100% 13.200 18.480 N Syt13 n/a
2 TRCN0000093424 CCAGGATCTTACATTCTGATT pLKO.1 3588 3UTR 100% 4.950 6.930 N Syt13 n/a
3 TRCN0000093428 CGTCCTCAGAACGGTGTAGTT pLKO.1 483 CDS 100% 4.950 6.930 N Syt13 n/a
4 TRCN0000379766 GGAACGAGATGATCATGTTTG pLKO_005 1153 CDS 100% 10.800 8.640 N Syt13 n/a
5 TRCN0000059477 CTCCTGGTGGTGCTGATTAAA pLKO.1 996 CDS 100% 15.000 10.500 N SYT13 n/a
6 TRCN0000307847 CTCCTGGTGGTGCTGATTAAA pLKO_005 996 CDS 100% 15.000 10.500 N SYT13 n/a
7 TRCN0000093427 ACCAGAAGAAGGCTGAGTTAT pLKO.1 592 CDS 100% 13.200 9.240 N Syt13 n/a
8 TRCN0000379700 AGAAGAAGGCTGAGTTATTTG pLKO_005 595 CDS 100% 13.200 9.240 N Syt13 n/a
9 TRCN0000382147 CCACTGGGAGGAGATGCTAAA pLKO_005 1301 CDS 100% 10.800 7.560 N Syt13 n/a
10 TRCN0000381019 TGCTCTGTCCACATGCCTATA pLKO_005 1446 3UTR 100% 10.800 7.560 N Syt13 n/a
11 TRCN0000381722 TTAAGTTCCCGGACATCTATG pLKO_005 316 CDS 100% 10.800 7.560 N Syt13 n/a
12 TRCN0000093426 GACCAGAAGAAGGCTGAGTTA pLKO.1 591 CDS 100% 4.950 3.465 N Syt13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_030725.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.