Transcript: Human NM_030753.5

Homo sapiens Wnt family member 3 (WNT3), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
WNT3 (7473)
Length:
3287
CDS:
96..1163

Additional Resources:

NCBI RefSeq record:
NM_030753.5
NBCI Gene record:
WNT3 (7473)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_030753.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000033382 CGGCTGTGACTCGCATCATAA pLKO.1 512 CDS 100% 13.200 18.480 N WNT3 n/a
2 TRCN0000373981 TCCTCGCTGGCTACCCAATTT pLKO_005 151 CDS 100% 13.200 18.480 N WNT3 n/a
3 TRCN0000033381 CCAGGAGTGTATTCGCATCTA pLKO.1 1121 CDS 100% 4.950 6.930 N WNT3 n/a
4 TRCN0000033379 TGGTAAATGACCCAGACCCAA pLKO.1 1295 3UTR 100% 2.640 3.696 N WNT3 n/a
5 TRCN0000033383 CCACAACACGAGGACGGAGAA pLKO.1 1049 CDS 100% 1.350 1.080 N WNT3 n/a
6 TRCN0000373980 GGACCACATGCACCTCAAATG pLKO_005 692 CDS 100% 10.800 7.560 N WNT3 n/a
7 TRCN0000033380 CCGCAATTACATCGAGATCAT pLKO.1 272 CDS 100% 4.950 3.465 N WNT3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_030753.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.