Transcript: Human NM_030758.4

Homo sapiens oxysterol binding protein 2 (OSBP2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
OSBP2 (23762)
Length:
4261
CDS:
37..2787

Additional Resources:

NCBI RefSeq record:
NM_030758.4
NBCI Gene record:
OSBP2 (23762)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_030758.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437430 CGCACTTAGCAGACAGCTTTC pLKO_005 3218 3UTR 100% 6.000 8.400 N OSBP2 n/a
2 TRCN0000437212 AGCGCCACCCTTGCAACAAAT pLKO_005 2787 CDS 100% 13.200 10.560 N OSBP2 n/a
3 TRCN0000150362 CTACAGAAATCAGGGTGAAAT pLKO.1 675 CDS 100% 13.200 9.240 N OSBP2 n/a
4 TRCN0000421321 GTTCATTAATGCACTCAATTT pLKO_005 2836 3UTR 100% 13.200 9.240 N OSBP2 n/a
5 TRCN0000413035 ATGAAGATACCGAGTACTTTG pLKO_005 1376 CDS 100% 10.800 7.560 N OSBP2 n/a
6 TRCN0000152082 CAATGGTTTGCTCTCTTACTA pLKO.1 657 CDS 100% 5.625 3.938 N OSBP2 n/a
7 TRCN0000151993 CATCACATCCAATGCTATGAT pLKO.1 1119 CDS 100% 5.625 3.938 N OSBP2 n/a
8 TRCN0000153631 CAAGGGTTCATCCAAAGTCAA pLKO.1 1539 CDS 100% 4.950 3.465 N OSBP2 n/a
9 TRCN0000154514 GCTTCTCAAGTGGACCAACTA pLKO.1 600 CDS 100% 4.950 3.465 N OSBP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_030758.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.