Transcript: Human NM_030777.4

Homo sapiens solute carrier family 2 member 10 (SLC2A10), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
SLC2A10 (81031)
Length:
4227
CDS:
89..1714

Additional Resources:

NCBI RefSeq record:
NM_030777.4
NBCI Gene record:
SLC2A10 (81031)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_030777.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000265759 TCTCCTATGCCCTCAACTATG pLKO_005 534 CDS 100% 10.800 15.120 N SLC2A10 n/a
2 TRCN0000042842 GATGGTCTTTGTCAGTGCCTT pLKO.1 1336 CDS 100% 2.640 3.696 N SLC2A10 n/a
3 TRCN0000042838 GCCTGGGCTTCATCTATTTAT pLKO.1 1554 CDS 100% 15.000 10.500 N SLC2A10 n/a
4 TRCN0000265768 CTACACATCAGGGCTTGATTT pLKO_005 3546 3UTR 100% 13.200 9.240 N SLC2A10 n/a
5 TRCN0000265744 CTGTGGTTGGCTTCGCCATTT pLKO_005 405 CDS 100% 10.800 7.560 N SLC2A10 n/a
6 TRCN0000256169 TCTCCTTCCTCGATCTCATTG pLKO_005 1479 CDS 100% 10.800 7.560 N SLC2A10 n/a
7 TRCN0000042840 CATCTTCAGCTCCGTTGGTTT pLKO.1 856 CDS 100% 4.950 3.465 N SLC2A10 n/a
8 TRCN0000042839 GCTTGCTGTATCTACGTGTCA pLKO.1 440 CDS 100% 2.640 1.848 N SLC2A10 n/a
9 TRCN0000042841 GTTATGAACTGGCAGTCATAT pLKO.1 156 CDS 100% 1.320 0.924 N SLC2A10 n/a
10 TRCN0000079417 TGCTGTATCTACGTGTCAGAA pLKO.1 443 CDS 100% 4.950 3.465 N Slc2a10 n/a
11 TRCN0000079415 GCTGTATCTACGTGTCAGAAT pLKO.1 444 CDS 100% 4.950 6.930 N Slc2a10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_030777.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04229 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04229 pLX_304 0% 100% 100% V5 n/a
Download CSV