Transcript: Human NM_030791.4

Homo sapiens sphingosine-1-phosphate phosphatase 1 (SGPP1), mRNA.

Source:
NCBI, updated 2019-06-09
Taxon:
Homo sapiens (human)
Gene:
SGPP1 (81537)
Length:
3336
CDS:
122..1447

Additional Resources:

NCBI RefSeq record:
NM_030791.4
NBCI Gene record:
SGPP1 (81537)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_030791.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000358903 GAACTTCCTTATCGGTATATT pLKO_005 1355 CDS 100% 15.000 21.000 N SGPP1 n/a
2 TRCN0000050195 CCTTATCGGTATATTACCTAT pLKO.1 1361 CDS 100% 4.950 6.930 N SGPP1 n/a
3 TRCN0000050194 CCATTCATCATCATCGGGCTT pLKO.1 995 CDS 100% 2.160 3.024 N SGPP1 n/a
4 TRCN0000050196 CTAGTATTAGATCCTTCTCTA pLKO.1 1142 CDS 100% 0.000 0.000 N SGPP1 n/a
5 TRCN0000358902 GCACTCTATTCTGGATATTAT pLKO_005 883 CDS 100% 15.000 10.500 N SGPP1 n/a
6 TRCN0000369679 GGATGGTATTTGTACTAATAA pLKO_005 1236 CDS 100% 15.000 10.500 N SGPP1 n/a
7 TRCN0000358905 GATCCTTCTCTAGATACATTA pLKO_005 1151 CDS 100% 13.200 9.240 N SGPP1 n/a
8 TRCN0000369751 TCCTAATTGAATTGCGTAATT pLKO_005 1930 3UTR 100% 13.200 9.240 N SGPP1 n/a
9 TRCN0000358835 TTAGGTGAGCTGAGCTATTTC pLKO_005 1621 3UTR 100% 13.200 9.240 N SGPP1 n/a
10 TRCN0000050193 CCTCTTATATATGGACTGATT pLKO.1 809 CDS 100% 4.950 3.465 N SGPP1 n/a
11 TRCN0000050197 GCTGGATTCCTATATACCATT pLKO.1 905 CDS 100% 4.950 2.970 N SGPP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_030791.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.