Transcript: Human NM_030802.4

Homo sapiens family with sequence similarity 117 member A (FAM117A), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
FAM117A (81558)
Length:
2329
CDS:
45..1406

Additional Resources:

NCBI RefSeq record:
NM_030802.4
NBCI Gene record:
FAM117A (81558)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_030802.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000369432 ATGGGCTTCATCTTCCGTAAC pLKO_005 1224 CDS 100% 6.000 8.400 N FAM117A n/a
2 TRCN0000369493 ACTTCAGGTCCGGCGTACATT pLKO_005 293 CDS 100% 5.625 7.875 N FAM117A n/a
3 TRCN0000364740 CTGTATAGGAGGCCCTTATTT pLKO_005 1719 3UTR 100% 15.000 10.500 N FAM117A n/a
4 TRCN0000376494 GCTGCTGAGGATCCTTGATAT pLKO_005 743 CDS 100% 13.200 9.240 N FAM117A n/a
5 TRCN0000377285 GTAGCTGGGCAGCTCACAATT pLKO_005 1610 3UTR 100% 13.200 9.240 N FAM117A n/a
6 TRCN0000364691 ATCATAGCTACATCTTCAAAC pLKO_005 1036 CDS 100% 10.800 7.560 N FAM117A n/a
7 TRCN0000166909 CAAGAACAAAGTCCATTTCAA pLKO.1 1148 CDS 100% 5.625 3.938 N FAM117A n/a
8 TRCN0000172251 CCTCCAGGAGACCATAAGATA pLKO.1 1802 3UTR 100% 5.625 3.938 N FAM117A n/a
9 TRCN0000167972 CAAGTTGAAGCAACAACTGCA pLKO.1 512 CDS 100% 0.264 0.185 N FAM117A n/a
10 TRCN0000172865 GACTTCCTGTCCTGACAAGAA pLKO.1 1133 CDS 100% 4.950 2.970 N FAM117A n/a
11 TRCN0000276926 TGGGCTTCATCTTCCGTAATT pLKO_005 1225 CDS 100% 13.200 9.240 N Fam117a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_030802.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15174 pDONR223 65% 99.7% 99.5% None 20_22delGCGinsNGA;510T>C n/a
2 ccsbBroad304_15174 pLX_304 0% 99.7% 99.5% V5 20_22delGCGinsNGA;510T>C n/a
Download CSV