Transcript: Human NM_030877.5

Homo sapiens catenin beta like 1 (CTNNBL1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
CTNNBL1 (56259)
Length:
1890
CDS:
94..1785

Additional Resources:

NCBI RefSeq record:
NM_030877.5
NBCI Gene record:
CTNNBL1 (56259)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_030877.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000075105 CGAGGAGAGATCATCGACAAT pLKO.1 1498 CDS 100% 4.950 6.930 N CTNNBL1 n/a
2 TRCN0000290263 CGAGGAGAGATCATCGACAAT pLKO_005 1498 CDS 100% 4.950 6.930 N CTNNBL1 n/a
3 TRCN0000075104 CGGATTAAGTTTCCAGACAAT pLKO.1 391 CDS 100% 4.950 6.930 N CTNNBL1 n/a
4 TRCN0000290262 CGGATTAAGTTTCCAGACAAT pLKO_005 391 CDS 100% 4.950 6.930 N CTNNBL1 n/a
5 TRCN0000075103 GCTCCTGTCTAATGCTTAGTT pLKO.1 1046 CDS 100% 5.625 3.938 N CTNNBL1 n/a
6 TRCN0000290260 GCTCCTGTCTAATGCTTAGTT pLKO_005 1046 CDS 100% 5.625 3.938 N CTNNBL1 n/a
7 TRCN0000075106 ACAGACTAATGGAGTTGCATT pLKO.1 1409 CDS 100% 4.950 3.465 N CTNNBL1 n/a
8 TRCN0000290327 ACAGACTAATGGAGTTGCATT pLKO_005 1409 CDS 100% 4.950 3.465 N CTNNBL1 n/a
9 TRCN0000075107 GCCATATTGCTCCAGGACAAT pLKO.1 892 CDS 100% 4.950 3.465 N CTNNBL1 n/a
10 TRCN0000290261 GCCATATTGCTCCAGGACAAT pLKO_005 892 CDS 100% 4.950 3.465 N CTNNBL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_030877.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12299 pDONR223 100% 55.2% 55.2% None 1_756del n/a
Download CSV