Transcript: Human NM_030958.3

Homo sapiens solute carrier organic anion transporter family member 5A1 (SLCO5A1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
SLCO5A1 (81796)
Length:
8991
CDS:
622..3168

Additional Resources:

NCBI RefSeq record:
NM_030958.3
NBCI Gene record:
SLCO5A1 (81796)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_030958.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423277 CAGTATACACAGCCGCTATTC pLKO_005 3298 3UTR 100% 10.800 15.120 N SLCO5A1 n/a
2 TRCN0000422837 GACCTTCATCCAGGCGTTAAT pLKO_005 1032 CDS 100% 13.200 9.240 N SLCO5A1 n/a
3 TRCN0000038240 GCCTCAAATTCGTTGGGTTTA pLKO.1 2852 CDS 100% 10.800 7.560 N SLCO5A1 n/a
4 TRCN0000038243 CCTTCCCAGAAGCAATAAGTT pLKO.1 3092 CDS 100% 5.625 3.938 N SLCO5A1 n/a
5 TRCN0000038242 GCACTGGGAATGCAGTTTGTT pLKO.1 2674 CDS 100% 5.625 3.938 N SLCO5A1 n/a
6 TRCN0000038241 CCAACCTACTTAGATGACAAT pLKO.1 1477 CDS 100% 4.950 3.465 N SLCO5A1 n/a
7 TRCN0000038239 CCCAATGTTTACTTTCCCAAA pLKO.1 1710 CDS 100% 4.050 2.835 N SLCO5A1 n/a
8 TRCN0000165027 GAACTCCTGACCTCAAGTGAT pLKO.1 6425 3UTR 100% 4.950 2.475 Y LOC387873 n/a
9 TRCN0000172742 GAGACAGAGTCTTGCTCTGTT pLKO.1 6222 3UTR 100% 0.495 0.248 Y C11orf44 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_030958.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.