Transcript: Mouse NM_031195.2

Mus musculus macrophage scavenger receptor 1 (Msr1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Mus musculus (mouse)
Gene:
Msr1 (20288)
Length:
3643
CDS:
59..1123

Additional Resources:

NCBI RefSeq record:
NM_031195.2
NBCI Gene record:
Msr1 (20288)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_031195.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000424638 ACGGAACGCTTCCAGAATTTC pLKO_005 482 CDS 100% 13.200 10.560 N Msr1 n/a
2 TRCN0000428572 TCGGGATCTCCTGGACCTAAA pLKO_005 1055 CDS 100% 10.800 8.640 N Msr1 n/a
3 TRCN0000072041 CGTGAATCTACAGCAAAGCAA pLKO.1 674 CDS 100% 3.000 2.400 N Msr1 n/a
4 TRCN0000072042 AGGCGGATCAAGATCAGTATA pLKO.1 1102 CDS 100% 13.200 9.240 N Msr1 n/a
5 TRCN0000072038 CCCTACTATCATCTCCTTAAA pLKO.1 1180 3UTR 100% 13.200 9.240 N Msr1 n/a
6 TRCN0000072040 GCAACTGACCAAAGACTTAAT pLKO.1 509 CDS 100% 13.200 9.240 N Msr1 n/a
7 TRCN0000072039 GCAGTTCAGAATCCGTGAAAT pLKO.1 120 CDS 100% 13.200 9.240 N Msr1 n/a
8 TRCN0000431188 CCATTGACATAAGTACCTTAT pLKO_005 1342 3UTR 100% 10.800 7.560 N Msr1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_031195.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.