Transcript: Human NM_031229.4

Homo sapiens RANBP2-type and C3HC4-type zinc finger containing 1 (RBCK1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-26
Taxon:
Homo sapiens (human)
Gene:
RBCK1 (10616)
Length:
3701
CDS:
460..1992

Additional Resources:

NCBI RefSeq record:
NM_031229.4
NBCI Gene record:
RBCK1 (10616)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_031229.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000007599 CCACAACACTCATCTGTCAAA pLKO.1 2285 3UTR 100% 4.950 6.930 N RBCK1 n/a
2 TRCN0000338233 CCACAACACTCATCTGTCAAA pLKO_005 2285 3UTR 100% 4.950 6.930 N RBCK1 n/a
3 TRCN0000338235 CAGAACTGCCACTGAGCTAAA pLKO_005 1978 CDS 100% 10.800 7.560 N RBCK1 n/a
4 TRCN0000338176 TCTTTGAGGATGATGTCAATG pLKO_005 1601 CDS 100% 10.800 7.560 N RBCK1 n/a
5 TRCN0000338234 CAGTGCCTTCAGCTACCATTG pLKO_005 1551 CDS 100% 6.000 4.200 N RBCK1 n/a
6 TRCN0000007602 CCCTGAGGATTACCAGCGATT pLKO.1 1497 CDS 100% 4.050 2.835 N RBCK1 n/a
7 TRCN0000338232 CCCTGAGGATTACCAGCGATT pLKO_005 1497 CDS 100% 4.050 2.835 N RBCK1 n/a
8 TRCN0000007601 GCAGATGAACTGCAAGGAGTA pLKO.1 1680 CDS 100% 4.050 2.835 N RBCK1 n/a
9 TRCN0000007600 GCAGGGTAAATGGGATTCCTT pLKO.1 1943 CDS 100% 3.000 2.100 N RBCK1 n/a
10 TRCN0000007603 GCCCTGATATGACAGTGGCGT pLKO.1 686 CDS 100% 0.220 0.154 N RBCK1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_031229.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11529 pDONR223 100% 44.4% 39.4% None (many diffs) n/a
2 ccsbBroad304_11529 pLX_304 0% 44.4% 39.4% V5 (many diffs) n/a
Download CSV