Transcript: Human NM_031411.2

Homo sapiens protocadherin alpha 1 (PCDHA1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
PCDHA1 (56147)
Length:
4623
CDS:
156..2216

Additional Resources:

NCBI RefSeq record:
NM_031411.2
NBCI Gene record:
PCDHA1 (56147)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_031411.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426901 GAACATTAGTGACCACATTAA pLKO_005 928 CDS 100% 13.200 9.240 N PCDHA1 n/a
2 TRCN0000432624 GATGCTGACGAAGGTGTAAAT pLKO_005 957 CDS 100% 13.200 9.240 N PCDHA1 n/a
3 TRCN0000053271 CAGTGGTATTTCTCGTGACAT pLKO.1 1001 CDS 100% 4.950 3.465 N PCDHA1 n/a
4 TRCN0000053268 CCCGAGTGATTATTTCTCTTT pLKO.1 674 CDS 100% 4.950 3.465 N PCDHA1 n/a
5 TRCN0000053270 GCAAGTGATGAACTGAGTAAA pLKO.1 705 CDS 100% 13.200 7.920 N PCDHA1 n/a
6 TRCN0000056018 GCCTGAAACATCTGTATTATA pLKO.1 3260 3UTR 100% 15.000 7.500 Y PCDHA8 n/a
7 TRCN0000094754 GCTGCTACAGAAGTGCTTTAA pLKO.1 3232 3UTR 100% 13.200 6.600 Y Pcdha5 n/a
8 TRCN0000053275 CTGGAGGTAAATCTGCAGAAT pLKO.1 378 CDS 100% 4.950 2.475 Y PCDHA9 n/a
9 TRCN0000094877 ACAAATTCATTATCCCAGGAT pLKO.1 2020 CDS 100% 2.640 1.320 Y Pcdha8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_031411.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.