Transcript: Human NM_031455.4

Homo sapiens coiled-coil domain containing 3 (CCDC3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
CCDC3 (83643)
Length:
2747
CDS:
144..956

Additional Resources:

NCBI RefSeq record:
NM_031455.4
NBCI Gene record:
CCDC3 (83643)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_031455.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416064 GTCCAGGACTACTCCTATTTC pLKO_005 486 CDS 100% 13.200 18.480 N CCDC3 n/a
2 TRCN0000428571 TTTCGTACATGCAGCTATTTC pLKO_005 1018 3UTR 100% 13.200 18.480 N CCDC3 n/a
3 TRCN0000133751 CGCATTTGGTAGAGTCTAAAT pLKO.1 1069 3UTR 100% 13.200 10.560 N CCDC3 n/a
4 TRCN0000137060 CCACCACTTCATTAGCTGTAT pLKO.1 2520 3UTR 100% 4.950 3.465 N CCDC3 n/a
5 TRCN0000134649 GCTGTGTGATTAAGAAGTCAA pLKO.1 2132 3UTR 100% 4.950 3.465 N CCDC3 n/a
6 TRCN0000138310 CTTTCTCCAGTGACTGGGAAA pLKO.1 655 CDS 100% 4.050 2.835 N CCDC3 n/a
7 TRCN0000138240 CCTCACGGAGTCAATTTCCAA pLKO.1 543 CDS 100% 3.000 2.100 N CCDC3 n/a
8 TRCN0000138208 CCAGAAACTCAGTGAGAAGCT pLKO.1 869 CDS 100% 2.640 1.848 N CCDC3 n/a
9 TRCN0000138226 CGAACCAGAAACTCAGTGAGA pLKO.1 865 CDS 100% 2.640 1.848 N CCDC3 n/a
10 TRCN0000138774 GAAGAAGGTCAAGAGGTCCTT pLKO.1 806 CDS 100% 2.640 1.848 N CCDC3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_031455.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.