Transcript: Human NM_032011.1

Homo sapiens protocadherin gamma subfamily A, 3 (PCDHGA3), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
PCDHGA3 (56112)
Length:
2490
CDS:
1..2490

Additional Resources:

NCBI RefSeq record:
NM_032011.1
NBCI Gene record:
PCDHGA3 (56112)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032011.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000053748 CCGCGAACAAATATCAGAATA pLKO.1 1233 CDS 100% 13.200 18.480 N PCDHGA3 n/a
2 TRCN0000416236 TAGATCAATATTACCGCTTAG pLKO_005 1193 CDS 100% 6.000 8.400 N PCDHGA3 n/a
3 TRCN0000414702 GGAACCCGATTTCCAATTAAA pLKO_005 445 CDS 100% 15.000 10.500 N PCDHGA3 n/a
4 TRCN0000434058 ATGCTCAAGTGTCTTATATTC pLKO_005 821 CDS 100% 13.200 9.240 N PCDHGA3 n/a
5 TRCN0000053749 CGAGCAATTTAGAGACTTAAA pLKO.1 1566 CDS 100% 13.200 9.240 N PCDHGA3 n/a
6 TRCN0000418332 GTGAGTGGAGAAGTATCAATA pLKO_005 889 CDS 100% 13.200 9.240 N PCDHGA3 n/a
7 TRCN0000053752 CCCTGCAGAACTACAAGCTTA pLKO.1 497 CDS 100% 4.950 3.465 N PCDHGA3 n/a
8 TRCN0000053750 GCCAAGATTCTAGTCACGGTT pLKO.1 991 CDS 100% 2.640 1.848 N PCDHGA3 n/a
9 TRCN0000053751 CCTGGGAAATCTGCCATTTAA pLKO.1 1158 CDS 100% 15.000 9.000 N PCDHGA3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032011.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.