Transcript: Human NM_032094.2

Homo sapiens protocadherin gamma subfamily A, 12 (PCDHGA12), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
PCDHGA12 (26025)
Length:
2716
CDS:
254..2716

Additional Resources:

NCBI RefSeq record:
NM_032094.2
NBCI Gene record:
PCDHGA12 (26025)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032094.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000056165 GCCATCAAGTGTCAATTAAAT pLKO.1 548 CDS 100% 15.000 21.000 N PCDHGA12 n/a
2 TRCN0000056167 CTGTCAGGTGATTCGGTATTT pLKO.1 2630 CDS 100% 13.200 18.480 N PCDHGA12 n/a
3 TRCN0000424775 TTGTAATTCAGGGACAATATC pLKO_005 1138 CDS 100% 13.200 18.480 N PCDHGA12 n/a
4 TRCN0000056163 GCAATGGATAATGCAGGATAT pLKO.1 1214 CDS 100% 10.800 7.560 N PCDHGA12 n/a
5 TRCN0000056166 CGCTTATATCCCAGAGAACAA pLKO.1 1627 CDS 100% 4.950 3.465 N PCDHGA12 n/a
6 TRCN0000056164 CCAAGGAAATCTGCCCTTTAA pLKO.1 1411 CDS 100% 13.200 7.920 N PCDHGA12 n/a
7 TRCN0000416489 TAAAGACAGTCATGGGTTAAT pLKO_005 2653 CDS 100% 13.200 7.920 N PCDHGA12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032094.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.