Transcript: Human NM_032149.3

Homo sapiens chromosome 4 open reading frame 17 (C4orf17), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
C4orf17 (84103)
Length:
1619
CDS:
346..1425

Additional Resources:

NCBI RefSeq record:
NM_032149.3
NBCI Gene record:
C4orf17 (84103)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032149.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000282710 GGGCAAAGGCAGCCATATTAT pLKO_005 384 CDS 100% 15.000 21.000 N C4orf17 n/a
2 TRCN0000263603 TTGCCGAGATAAACCTGTTAA pLKO_005 1010 CDS 100% 13.200 18.480 N C4orf17 n/a
3 TRCN0000263602 ACAAGCCTCCACTACTTATAA pLKO_005 1235 CDS 100% 15.000 10.500 N C4orf17 n/a
4 TRCN0000263601 CAGTGAGAATCCCTTAGTAAT pLKO_005 720 CDS 100% 13.200 9.240 N C4orf17 n/a
5 TRCN0000263604 TGAATATGAGCTTCACATTTA pLKO_005 1453 3UTR 100% 13.200 9.240 N C4orf17 n/a
6 TRCN0000167083 CAAGTCAAGGATCTGAAGAAA pLKO.1 1187 CDS 100% 5.625 3.938 N C4orf17 n/a
7 TRCN0000167682 GCTTCACATTTACATCATCAA pLKO.1 1462 3UTR 100% 4.950 3.465 N C4orf17 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032149.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09149 pDONR223 100% 99.7% 99.1% None 191G>A;253T>C;271G>A n/a
2 ccsbBroad304_09149 pLX_304 0% 99.7% 99.1% V5 191G>A;253T>C;271G>A n/a
Download CSV