Transcript: Human NM_032222.3

Homo sapiens MINDY lysine 48 deubiquitinase 4 (MINDY4), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
MINDY4 (84182)
Length:
2733
CDS:
78..2351

Additional Resources:

NCBI RefSeq record:
NM_032222.3
NBCI Gene record:
MINDY4 (84182)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032222.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413140 TGGAGATGTACTTGGTAATTT pLKO_005 512 CDS 100% 15.000 7.500 Y MINDY4 n/a
2 TRCN0000428557 CATTGCTGCACGCAGTGATAT pLKO_005 1988 CDS 100% 13.200 6.600 Y MINDY4 n/a
3 TRCN0000434807 GACCGTTGGATGTGGGTAAAC pLKO_005 2350 CDS 100% 10.800 5.400 Y MINDY4 n/a
4 TRCN0000134883 CTTTGGAAATACGGCTAACAA pLKO.1 320 CDS 100% 5.625 2.813 Y MINDY4 n/a
5 TRCN0000133830 CAGATACTTTCTGGATCACTT pLKO.1 302 CDS 100% 4.950 2.475 Y MINDY4 n/a
6 TRCN0000136407 CCTTGAACTCATCACCAGATA pLKO.1 287 CDS 100% 4.950 2.475 Y MINDY4 n/a
7 TRCN0000136899 CAGCTTAGTGAACTGACCGTA pLKO.1 897 CDS 100% 2.640 1.320 Y MINDY4 n/a
8 TRCN0000136406 CATTACAACATGTGCCAGGTT pLKO.1 2031 CDS 100% 2.640 1.320 Y MINDY4 n/a
9 TRCN0000136966 CCTTCTGTTTGGTTCCAGCTT pLKO.1 1328 CDS 100% 2.640 1.320 Y MINDY4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032222.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.