Transcript: Human NM_032383.5

Homo sapiens HPS3 biogenesis of lysosomal organelles complex 2 subunit 1 (HPS3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-26
Taxon:
Homo sapiens (human)
Gene:
HPS3 (84343)
Length:
4611
CDS:
87..3101

Additional Resources:

NCBI RefSeq record:
NM_032383.5
NBCI Gene record:
HPS3 (84343)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032383.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232932 CATGGGTTCACGTCGTAATAT pLKO_005 2602 CDS 100% 15.000 21.000 N HPS3 n/a
2 TRCN0000232930 ATCCGAATGATTGGGCATAAT pLKO_005 402 CDS 100% 13.200 18.480 N HPS3 n/a
3 TRCN0000082956 GCACGTCATTACAAGTAACAA pLKO.1 1235 CDS 100% 5.625 7.875 N HPS3 n/a
4 TRCN0000232933 TACCGTGTAGTGGTAACTATT pLKO_005 3269 3UTR 100% 0.000 0.000 N HPS3 n/a
5 TRCN0000232929 CAGCGAGGCTGGAGATTATTT pLKO_005 293 CDS 100% 15.000 10.500 N HPS3 n/a
6 TRCN0000082957 CTGTAGTCATTATGGCTTAAT pLKO.1 2576 CDS 100% 13.200 9.240 N HPS3 n/a
7 TRCN0000082953 GCTCTGTTTCTCTGAATCAAA pLKO.1 3650 3UTR 100% 5.625 3.938 N HPS3 n/a
8 TRCN0000082954 GCTCCTGATATTTCGTCCTAT pLKO.1 978 CDS 100% 4.950 3.465 N HPS3 n/a
9 TRCN0000082955 GCCTGTAGTCATTATGGCTTA pLKO.1 2574 CDS 100% 4.050 2.835 N HPS3 n/a
10 TRCN0000232931 ATAAGACCAACAATCGAATAA pLKO_005 763 CDS 100% 13.200 7.920 N HPS3 n/a
11 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3198 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032383.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09184 pDONR223 100% 99.9% 99.9% None 1494G>A;3002A>N n/a
2 ccsbBroad304_09184 pLX_304 0% 99.9% 99.9% V5 1494G>A;3002A>N n/a
Download CSV