Transcript: Human NM_032427.4

Homo sapiens mastermind like transcriptional coactivator 2 (MAML2), mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
MAML2 (84441)
Length:
7121
CDS:
1301..4771

Additional Resources:

NCBI RefSeq record:
NM_032427.4
NBCI Gene record:
MAML2 (84441)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032427.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232804 AGGCCACCTCCAGATTATAAA pLKO_005 3686 CDS 100% 15.000 21.000 N MAML2 n/a
2 TRCN0000232803 GACCATCACCAGGTCCATTTG pLKO_005 2706 CDS 100% 10.800 15.120 N MAML2 n/a
3 TRCN0000232805 TACCTTAGGGCCAAGTAATAA pLKO_005 4036 CDS 100% 0.000 0.000 N MAML2 n/a
4 TRCN0000118838 CCTGTTTAACATGGGCTTAAA pLKO.1 2068 CDS 100% 1.320 1.056 N MAML2 n/a
5 TRCN0000232806 CAGGATACAGTATCCAATTTA pLKO_005 4999 3UTR 100% 15.000 10.500 N MAML2 n/a
6 TRCN0000232802 TCAATGAACTGACCAACATAT pLKO_005 2229 CDS 100% 13.200 9.240 N MAML2 n/a
7 TRCN0000118837 CCCTGTCTAAACTCCAGGATA pLKO.1 4985 3UTR 100% 4.950 3.465 N MAML2 n/a
8 TRCN0000118840 GCCAAACACTAAATGGGCAAA pLKO.1 4398 CDS 100% 4.050 2.835 N MAML2 n/a
9 TRCN0000118839 CCCAAAGCAATTGTTAGCAAA pLKO.1 3985 CDS 100% 4.950 2.970 N MAML2 n/a
10 TRCN0000118841 CCACAGAGAACATCAAACGTA pLKO.1 4145 CDS 100% 3.000 1.800 N MAML2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032427.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12817 pDONR223 100% 99.7% 99.7% None 1398T>C;1780_1788delCAGCAGCAG n/a
2 ccsbBroad304_12817 pLX_304 0% 99.7% 99.7% V5 1398T>C;1780_1788delCAGCAGCAG n/a
Download CSV