Transcript: Human NM_032656.4

Homo sapiens DEAH-box helicase 37 (DHX37), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
DHX37 (57647)
Length:
4559
CDS:
110..3583

Additional Resources:

NCBI RefSeq record:
NM_032656.4
NBCI Gene record:
DHX37 (57647)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032656.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419497 ATGAGAGCTCGATCCCGTATG pLKO_005 3726 3UTR 100% 6.000 8.400 N DHX37 n/a
2 TRCN0000050947 CCAATTCTCTCCGAAGAACAA pLKO.1 866 CDS 100% 4.950 6.930 N DHX37 n/a
3 TRCN0000050945 CCTTCAAATGAAGGCGCTCAA pLKO.1 2236 CDS 100% 0.405 0.567 N DHX37 n/a
4 TRCN0000050944 CCAGATCAACTTGGATCATTA pLKO.1 1708 CDS 100% 13.200 10.560 N DHX37 n/a
5 TRCN0000424667 GAAATCGTGGAGACCACTAAG pLKO_005 3059 CDS 100% 10.800 7.560 N DHX37 n/a
6 TRCN0000416325 TTGGTGACTTCGAGCAGTTTC pLKO_005 2175 CDS 100% 10.800 7.560 N DHX37 n/a
7 TRCN0000050943 CCTCAGTTTGTCTCCCTTGTT pLKO.1 4307 3UTR 100% 4.950 3.465 N DHX37 n/a
8 TRCN0000050946 GACACGTTGAAGGGAGTTGAT pLKO.1 221 CDS 100% 4.950 3.465 N DHX37 n/a
9 TRCN0000426507 AGAAGCAAGCACAGGTCTTTA pLKO_005 1908 CDS 100% 13.200 7.920 N DHX37 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032656.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.