Transcript: Human NM_033049.4

Homo sapiens mucin 13, cell surface associated (MUC13), mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
MUC13 (56667)
Length:
2879
CDS:
40..1578

Additional Resources:

NCBI RefSeq record:
NM_033049.4
NBCI Gene record:
MUC13 (56667)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_033049.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000155447 GACTCGACTGTAAGGACAAAT pLKO.1 1274 CDS 100% 13.200 18.480 N MUC13 n/a
2 TRCN0000151975 CCTGTGCAGATAATTCGTTAT pLKO.1 581 CDS 100% 10.800 15.120 N MUC13 n/a
3 TRCN0000156568 GCACAGCACAAGCAATGCTTA pLKO.1 1156 CDS 100% 4.950 3.960 N MUC13 n/a
4 TRCN0000423554 ACCAATGTACAAGCTATTATT pLKO_005 1613 3UTR 100% 15.000 10.500 N MUC13 n/a
5 TRCN0000429044 TTGAGTTAAGTGACCTAATTC pLKO_005 1967 3UTR 100% 13.200 9.240 N MUC13 n/a
6 TRCN0000151974 CCACAGAAGACAATCAATCAT pLKO.1 479 CDS 100% 5.625 3.938 N MUC13 n/a
7 TRCN0000157462 GCAACTCAGCTGATGCTGTAA pLKO.1 104 CDS 100% 4.950 3.465 N MUC13 n/a
8 TRCN0000158288 CAACCACAGAAACTGCGACTA pLKO.1 125 CDS 100% 4.050 2.835 N MUC13 n/a
9 TRCN0000155709 CCCAGAAGAGAAACATTCCAT pLKO.1 726 CDS 100% 3.000 2.100 N MUC13 n/a
10 TRCN0000150953 GAAGAGAACTTGATTGACGAA pLKO.1 1405 CDS 100% 2.640 1.848 N MUC13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_033049.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.