Transcript: Mouse NM_033074.3

Mus musculus threonyl-tRNA synthetase (Tars), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Tars (110960)
Length:
2636
CDS:
120..2288

Additional Resources:

NCBI RefSeq record:
NM_033074.3
NBCI Gene record:
Tars (110960)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_033074.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000075969 CGGCTTCTATTATGATATGTA pLKO.1 659 CDS 100% 5.625 7.875 N Tars n/a
2 TRCN0000318318 CGGCTTCTATTATGATATGTA pLKO_005 659 CDS 100% 5.625 7.875 N Tars n/a
3 TRCN0000075971 GCGGATCTATGGCATTTCATT pLKO.1 1001 CDS 100% 5.625 7.875 N Tars n/a
4 TRCN0000349543 GCGGATCTATGGCATTTCATT pLKO_005 1001 CDS 100% 5.625 7.875 N Tars n/a
5 TRCN0000075968 CAAGTCTTAGAGAATGTTGTA pLKO.1 2414 3UTR 100% 4.950 3.465 N Tars n/a
6 TRCN0000318243 CAAGTCTTAGAGAATGTTGTA pLKO_005 2414 3UTR 100% 4.950 3.465 N Tars n/a
7 TRCN0000075972 CAGTATAACTTCATCCTTGTT pLKO.1 2121 CDS 100% 4.950 3.465 N Tars n/a
8 TRCN0000318319 CAGTATAACTTCATCCTTGTT pLKO_005 2121 CDS 100% 4.950 3.465 N Tars n/a
9 TRCN0000222674 GCACAGTATAACTTCATCCTT pLKO.1 2118 CDS 100% 3.000 2.100 N Tars n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_033074.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15604 pDONR223 0% 85.5% 93.3% None (many diffs) n/a
2 ccsbBroad304_15604 pLX_304 0% 85.5% 93.3% V5 (many diffs) n/a
Download CSV