Transcript: Mouse NM_033079.2

Mus musculus meiosis 1 associated protein (M1ap), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
M1ap (110958)
Length:
2051
CDS:
90..1679

Additional Resources:

NCBI RefSeq record:
NM_033079.2
NBCI Gene record:
M1ap (110958)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_033079.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000248252 GGATCATCCAATATGTCTAAA pLKO_005 848 CDS 100% 13.200 18.480 N M1ap n/a
2 TRCN0000248251 GTGATCTCCAAGAGCGATTTC pLKO_005 871 CDS 100% 10.800 15.120 N M1ap n/a
3 TRCN0000248254 GGCTTCAGCCTCTCCGTATAA pLKO_005 986 CDS 100% 13.200 10.560 N M1ap n/a
4 TRCN0000248255 GGACTCTCTCTTGGATCATTT pLKO_005 1864 3UTR 100% 13.200 9.240 N M1ap n/a
5 TRCN0000248253 GAAAGATATAAACCTACTTAG pLKO_005 575 CDS 100% 10.800 7.560 N M1ap n/a
6 TRCN0000191739 GAGCTGGAAACAAATCAACAA pLKO.1 1113 CDS 100% 4.950 3.465 N M1ap n/a
7 TRCN0000201582 CCTTCATTCTCAGACCCACAA pLKO.1 1069 CDS 100% 4.050 2.835 N M1ap n/a
8 TRCN0000192798 GCTTCTATGTGATCACACCTT pLKO.1 1237 CDS 100% 2.640 1.848 N M1ap n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_033079.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.