Transcript: Human NM_033176.2

Homo sapiens NK2 homeobox 4 (NKX2-4), mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
NKX2-4 (644524)
Length:
1738
CDS:
128..1192

Additional Resources:

NCBI RefSeq record:
NM_033176.2
NBCI Gene record:
NKX2-4 (644524)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_033176.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000265854 CCGGAAACCGAGTAGTGTAAC pLKO_005 1373 3UTR 100% 10.800 15.120 N NKX2-4 n/a
2 TRCN0000255902 ACCCACGCTACTCGTCAATCT pLKO_005 552 CDS 100% 4.950 6.930 N NKX2-4 n/a
3 TRCN0000081689 CATCGAGGAGACCTACAAGAA pLKO.1 184 CDS 100% 4.950 3.465 N Nkx2-4 n/a
4 TRCN0000281471 CCATCGAGGAGACCTACAAGA pLKO_005 183 CDS 100% 4.950 3.465 N NKX2-4 n/a
5 TRCN0000081688 CTACTCGTCAATCTCCAGGTT pLKO.1 559 CDS 100% 2.640 1.848 N Nkx2-4 n/a
6 TRCN0000255904 TTCTCCGTGTCCGACATCCTG pLKO_005 158 CDS 100% 0.880 0.616 N NKX2-4 n/a
7 TRCN0000255903 ACCACCGGTACAAGATGAAAC pLKO_005 843 CDS 100% 10.800 6.480 N NKX2-4 n/a
8 TRCN0000081690 GCCGCCACCTACCACATGCCT pLKO.1 395 CDS 100% 0.000 0.000 N Nkx2-4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_033176.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.