Transcript: Human NM_033225.6

Homo sapiens CUB and Sushi multiple domains 1 (CSMD1), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
CSMD1 (64478)
Length:
14417
CDS:
499..11193

Additional Resources:

NCBI RefSeq record:
NM_033225.6
NBCI Gene record:
CSMD1 (64478)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_033225.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413811 GCACCTGCCTTGCCAATTTAA pLKO_005 10262 CDS 100% 15.000 10.500 N CSMD1 n/a
2 TRCN0000423712 TGAGTACGGTGCTCAAGTATT pLKO_005 8232 CDS 100% 13.200 9.240 N CSMD1 n/a
3 TRCN0000220594 GCCCAAGGTTTCAAAGCATTA pLKO.1 886 CDS 100% 10.800 7.560 N CSMD1 n/a
4 TRCN0000220593 CCCATGTATGATACAAACTTA pLKO.1 11107 CDS 100% 5.625 3.938 N CSMD1 n/a
5 TRCN0000220591 CCTGGCTGCATCTGTATGAAA pLKO.1 11418 3UTR 100% 5.625 3.938 N CSMD1 n/a
6 TRCN0000220592 CCCTGAATGATTTGGCAGAAT pLKO.1 5516 CDS 100% 4.950 3.465 N CSMD1 n/a
7 TRCN0000220595 CCTGCATTGATCCTGCTCATA pLKO.1 10118 CDS 100% 4.950 3.465 N CSMD1 n/a
8 TRCN0000101370 CCTCTGATGGACAAGCAGTAA pLKO.1 11230 3UTR 100% 4.950 3.465 N Csmd1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_033225.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.