Transcript: Human NM_033226.2

Homo sapiens ATP binding cassette subfamily C member 12 (ABCC12), mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
ABCC12 (94160)
Length:
5168
CDS:
347..4426

Additional Resources:

NCBI RefSeq record:
NM_033226.2
NBCI Gene record:
ABCC12 (94160)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_033226.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000429405 GGATATCAGTGTATGTCATAT pLKO_005 1143 CDS 100% 13.200 18.480 N ABCC12 n/a
2 TRCN0000418800 GGGAACCCACAAGGAGTTAAT pLKO_005 2392 CDS 100% 13.200 18.480 N ABCC12 n/a
3 TRCN0000432586 TGTTGGCGAGGTGCTCAATAT pLKO_005 994 CDS 100% 13.200 18.480 N ABCC12 n/a
4 TRCN0000059272 CGGAAAGTCATCGTTAGGAAT pLKO.1 3820 CDS 100% 4.950 6.930 N ABCC12 n/a
5 TRCN0000059270 GCGATGTTACTAGCAGCAGAA pLKO.1 4394 CDS 100% 4.050 5.670 N ABCC12 n/a
6 TRCN0000059271 CCGGTGATTCTCATTCACCAA pLKO.1 767 CDS 100% 0.264 0.370 N ABCC12 n/a
7 TRCN0000425992 ACATATCACACGTACATTAAG pLKO_005 2687 CDS 100% 13.200 9.240 N ABCC12 n/a
8 TRCN0000436201 CAAGGATCCTGAACACCTTTA pLKO_005 2467 CDS 100% 10.800 7.560 N ABCC12 n/a
9 TRCN0000059269 GCTCAGAATTTGTAGACACAA pLKO.1 2604 CDS 100% 4.950 3.465 N ABCC12 n/a
10 TRCN0000059268 GCTGACATTATCCTGCCACAT pLKO.1 1423 CDS 100% 4.050 2.835 N ABCC12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_033226.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.