Transcript: Mouse NM_033268.4

Mus musculus actinin alpha 2 (Actn2), mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Actn2 (11472)
Length:
3091
CDS:
233..2917

Additional Resources:

NCBI RefSeq record:
NM_033268.4
NBCI Gene record:
Actn2 (11472)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_033268.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000072026 CGGTTCCACAAGATTGCGAAT pLKO.1 509 CDS 100% 4.050 5.670 N Actn2 n/a
2 TRCN0000072023 CCCTACCCTATCAGAATGCAA pLKO.1 2933 3UTR 100% 3.000 4.200 N Actn2 n/a
3 TRCN0000072024 GCCCGCATTATGACTTTGGTT pLKO.1 2615 CDS 100% 3.000 4.200 N Actn2 n/a
4 TRCN0000072025 CCGACCTCATTGACTACTCAA pLKO.1 816 CDS 100% 4.950 3.960 N Actn2 n/a
5 TRCN0000435058 GACCTCATTGACTACTCAAAG pLKO_005 818 CDS 100% 10.800 7.560 N ACTN2 n/a
6 TRCN0000055869 GCCTGATGGATCATGAGGATT pLKO.1 2544 CDS 100% 4.950 3.465 N ACTN2 n/a
7 TRCN0000072027 GCTAACAGAATATGTAAGGTT pLKO.1 1028 CDS 100% 3.000 2.100 N Actn2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_033268.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00017 pDONR223 100% 91% 99.2% None (many diffs) n/a
2 ccsbBroad304_00017 pLX_304 0% 91% 99.2% V5 (many diffs) n/a
Download CSV