Transcript: Human NM_033437.3

Homo sapiens phosphodiesterase 5A (PDE5A), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Homo sapiens (human)
Gene:
PDE5A (8654)
Length:
6788
CDS:
95..2566

Additional Resources:

NCBI RefSeq record:
NM_033437.3
NBCI Gene record:
PDE5A (8654)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_033437.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431208 TGATATCTGCTGACCGCTATT pLKO_005 474 CDS 100% 10.800 15.120 N PDE5A n/a
2 TRCN0000434598 CATAGAACCCACTGATCTAAT pLKO_005 2332 CDS 100% 13.200 10.560 N PDE5A n/a
3 TRCN0000048745 CCCAGATGTCAGTAAGGATAA pLKO.1 1210 CDS 100% 10.800 8.640 N PDE5A n/a
4 TRCN0000048744 GCATTCTTTGTATGCCAATTA pLKO.1 732 CDS 100% 13.200 9.240 N PDE5A n/a
5 TRCN0000414817 TTAAGCCTTTCAACCGAAATG pLKO_005 1380 CDS 100% 10.800 7.560 N PDE5A n/a
6 TRCN0000048743 CCAGCTTTACTGCCATTCAAT pLKO.1 1957 CDS 100% 5.625 3.938 N PDE5A n/a
7 TRCN0000048746 CCTCGGTTCAATGCAGAAGTT pLKO.1 683 CDS 100% 4.950 3.465 N PDE5A n/a
8 TRCN0000048747 GCATTGCTGATTGCTGCACTA pLKO.1 1871 CDS 100% 4.050 2.835 N PDE5A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_033437.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.