Transcript: Human NM_033542.4

Homo sapiens SYS1 golgi trafficking protein (SYS1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
SYS1 (90196)
Length:
2728
CDS:
164..634

Additional Resources:

NCBI RefSeq record:
NM_033542.4
NBCI Gene record:
SYS1 (90196)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_033542.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263154 CTAAATCCAATGTCTAGAATC pLKO_005 618 CDS 100% 10.800 15.120 N SYS1 n/a
2 TRCN0000263152 GGACCTCTTTGAGGGTAATAA pLKO_005 868 3UTR 100% 15.000 10.500 N SYS1 n/a
3 TRCN0000263151 TTTCACTGTCACTGTCCATTT pLKO_005 442 CDS 100% 10.800 7.560 N SYS1 n/a
4 TRCN0000263150 TACTTCATCCGGCGAGGAAAG pLKO_005 410 CDS 100% 6.000 4.200 N SYS1 n/a
5 TRCN0000263153 TCCTCATGCAGACCGTGTATT pLKO_005 222 CDS 100% 13.200 6.600 Y SYS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_033542.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04507 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04507 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000478328 CACTACCTCATGAAATGAGAACCA pLX_317 60.8% 100% 100% V5 n/a
Download CSV