Transcript: Mouse NM_033609.3

Mus musculus mediator complex subunit 15 (Med15), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Med15 (94112)
Length:
3413
CDS:
125..2494

Additional Resources:

NCBI RefSeq record:
NM_033609.3
NBCI Gene record:
Med15 (94112)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_033609.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000277062 TCGACCGTCAGTGGCAATATG pLKO_005 2337 CDS 100% 13.200 18.480 N Med15 n/a
2 TRCN0000175485 CGACTCATTATCCATTTCCGA pLKO.1 305 CDS 100% 0.750 1.050 N Med15 n/a
3 TRCN0000328748 CATTATCCATTTCCGAGATAT pLKO_005 310 CDS 100% 13.200 10.560 N Med15 n/a
4 TRCN0000277060 GTTTGGTTTGTTTCGTTATTT pLKO_005 2728 3UTR 100% 15.000 10.500 N Med15 n/a
5 TRCN0000175122 CACCTGATTAAGTTGCATCAT pLKO.1 791 CDS 100% 4.950 3.465 N Med15 n/a
6 TRCN0000175346 CCCATCAAAGCATCTCTGTTT pLKO.1 2840 3UTR 100% 4.950 3.465 N Med15 n/a
7 TRCN0000194165 GCTATGATACACAGGCAGATA pLKO.1 3172 3UTR 100% 4.950 3.465 N Med15 n/a
8 TRCN0000175823 GCTGAAGCAATTGTCCAAGTA pLKO.1 1732 CDS 100% 4.950 3.465 N Med15 n/a
9 TRCN0000328801 GCTGAAGCAATTGTCCAAGTA pLKO_005 1732 CDS 100% 4.950 3.465 N Med15 n/a
10 TRCN0000175270 CATGATCAACAAGATCGACAA pLKO.1 1771 CDS 100% 4.050 2.835 N Med15 n/a
11 TRCN0000277061 CATGATCAACAAGATCGACAA pLKO_005 1771 CDS 100% 4.050 2.835 N Med15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_033609.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.