Transcript: Human NM_033631.4

Homo sapiens leucine zipper protein 1 (LUZP1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
LUZP1 (7798)
Length:
8478
CDS:
383..3613

Additional Resources:

NCBI RefSeq record:
NM_033631.4
NBCI Gene record:
LUZP1 (7798)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_033631.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000142862 CGTGGAATCTACCAATAGCAA pLKO.1 3211 CDS 100% 3.000 4.200 N LUZP1 n/a
2 TRCN0000144333 CCTCCCTATTTGAGAATGATA pLKO.1 2487 CDS 100% 5.625 4.500 N LUZP1 n/a
3 TRCN0000143886 CGGTTTAAGCTACAGAGTCTA pLKO.1 431 CDS 100% 4.950 3.960 N LUZP1 n/a
4 TRCN0000140643 GCTGATAACAGTTGCCCGAAT pLKO.1 2150 CDS 100% 4.050 3.240 N LUZP1 n/a
5 TRCN0000415760 GTTCTATCGAAGTATCCTTAT pLKO_005 2183 CDS 100% 10.800 7.560 N LUZP1 n/a
6 TRCN0000412976 TGTGGTTAATGTTCTGGTTTC pLKO_005 3993 3UTR 100% 6.000 4.200 N LUZP1 n/a
7 TRCN0000144866 GCGAGACTTGAAATCTTTAGA pLKO.1 3163 CDS 100% 5.625 3.938 N LUZP1 n/a
8 TRCN0000415740 GAGGGAATCAGAGACTACAAG pLKO_005 3779 3UTR 100% 4.950 3.465 N LUZP1 n/a
9 TRCN0000143296 GCAGGAGTAAGAATGACTGTA pLKO.1 765 CDS 100% 4.950 3.465 N LUZP1 n/a
10 TRCN0000140274 GCAGGTTTCTTCTCCCAGTTT pLKO.1 1639 CDS 100% 4.950 3.465 N LUZP1 n/a
11 TRCN0000140802 GCTGGAAATGCTCAGAGTCAA pLKO.1 844 CDS 100% 4.950 3.465 N LUZP1 n/a
12 TRCN0000139718 CTAAGTTTAGAGGCCACGGAA pLKO.1 1503 CDS 100% 2.640 1.848 N LUZP1 n/a
13 TRCN0000155912 CCAGATACCAATGGTGCTGTT pLKO.1 2573 CDS 100% 4.050 2.025 Y DDX19A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_033631.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.