Transcript: Mouse NM_052994.2

Mus musculus sparc/osteonectin, cwcv and kazal-like domains proteoglycan 2 (Spock2), mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Spock2 (94214)
Length:
3931
CDS:
212..1483

Additional Resources:

NCBI RefSeq record:
NM_052994.2
NBCI Gene record:
Spock2 (94214)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_052994.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000080364 CGGCAAGATTAAGCACTGGAA pLKO.1 367 CDS 100% 2.640 2.112 N Spock2 n/a
2 TRCN0000080365 CCATCGGTTGGATGTTCTCTA pLKO.1 954 CDS 100% 4.950 3.465 N Spock2 n/a
3 TRCN0000080363 CCCTGATAGATTATCTCTCAA pLKO.1 2268 3UTR 100% 4.950 3.465 N Spock2 n/a
4 TRCN0000080366 CTGTGATGACATCGTGGGTTT pLKO.1 1333 CDS 100% 4.050 2.835 N Spock2 n/a
5 TRCN0000080367 CTTCAACTCCTGTGATACCTA pLKO.1 1063 CDS 100% 3.000 2.100 N Spock2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_052994.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.