Transcript: Human NM_053067.3

Homo sapiens ubiquilin 1 (UBQLN1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
UBQLN1 (29979)
Length:
3784
CDS:
280..1965

Additional Resources:

NCBI RefSeq record:
NM_053067.3
NBCI Gene record:
UBQLN1 (29979)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_053067.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000429289 GACCAACTTGTGTTGATATTT pLKO_005 499 CDS 100% 15.000 21.000 N UBQLN1 n/a
2 TRCN0000430561 AGAGTACTACTGCGCCAAATT pLKO_005 1346 CDS 100% 13.200 18.480 N UBQLN1 n/a
3 TRCN0000004373 GCTTCTCCCATAGGTAGTTTA pLKO.1 2815 3UTR 100% 13.200 18.480 N UBQLN1 n/a
4 TRCN0000004374 AGGTCTGAGTAGCTTGGGTTT pLKO.1 747 CDS 100% 4.050 5.670 N UBQLN1 n/a
5 TRCN0000004372 GTTACAGATTCAGCAGGGTTT pLKO.1 1584 CDS 100% 4.050 3.240 N UBQLN1 n/a
6 TRCN0000004371 CCTCAGCTACAGAATCCAGAA pLKO.1 1807 CDS 100% 4.050 2.835 N UBQLN1 n/a
7 TRCN0000087735 CCAGAAGTCAGATTTCAGCAA pLKO.1 1822 CDS 100% 2.640 1.320 Y Ubqln1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_053067.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.