Transcript: Mouse NM_053096.3

Mus musculus N-acetyltransferase 8 (GCN5-related) family member 2 (Nat8f2), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Nat8f2 (93673)
Length:
3280
CDS:
324..1040

Additional Resources:

NCBI RefSeq record:
NM_053096.3
NBCI Gene record:
Nat8f2 (93673)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_053096.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000114612 CCAGGGTATAGTGGGAAATAT pLKO.1 993 CDS 100% 15.000 21.000 N Nat8f2 n/a
2 TRCN0000114615 CAGGGTATAGTGGGAAATATT pLKO.1 994 CDS 100% 15.000 10.500 N Nat8f2 n/a
3 TRCN0000114613 GCCAGTACTTTGTCAGTATAA pLKO.1 910 CDS 100% 13.200 9.240 N Nat8f2 n/a
4 TRCN0000114614 GCCTGTGACCATAGTATTGAT pLKO.1 470 CDS 100% 5.625 3.938 N Nat8f2 n/a
5 TRCN0000114596 GCCGGGAAGATGTATGTTGTA pLKO.1 2531 3UTR 100% 4.950 2.970 N Nat8f4 n/a
6 TRCN0000114611 GCACACACATACTTTCTGATT pLKO.1 2577 3UTR 100% 4.950 2.475 Y Nat8f2 n/a
7 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2922 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_053096.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.