Transcript: Mouse NM_053137.2

Mus musculus protocadherin beta 12 (Pcdhb12), mRNA.

Source:
NCBI, updated 2015-07-31
Taxon:
Mus musculus (mouse)
Gene:
Pcdhb12 (93883)
Length:
3034
CDS:
183..2552

Additional Resources:

NCBI RefSeq record:
NM_053137.2
NBCI Gene record:
Pcdhb12 (93883)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_053137.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416676 GAGTCAACTCTTGAGATATAT pLKO_005 2628 3UTR 100% 15.000 21.000 N Pcdhb12 n/a
2 TRCN0000094494 CGTCTGACCAAAGAGCTAGAT pLKO.1 1062 CDS 100% 4.950 6.930 N Pcdhb12 n/a
3 TRCN0000094496 GTAAGTCACCATTATACCATA pLKO.1 1089 CDS 100% 4.950 6.930 N Pcdhb12 n/a
4 TRCN0000094497 CAATTCACCTTTCGTGCTCTA pLKO.1 1826 CDS 100% 4.050 5.670 N Pcdhb12 n/a
5 TRCN0000094498 CTGACTCTGAGGCAATTAGAT pLKO.1 238 CDS 100% 5.625 3.938 N Pcdhb12 n/a
6 TRCN0000094495 GTCACCATTATACCATAGAAA pLKO.1 1093 CDS 100% 5.625 3.938 N Pcdhb12 n/a
7 TRCN0000428707 GGACTTAGATGCTGGGATATA pLKO_005 962 CDS 100% 13.200 7.920 N Pcdhb12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_053137.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.